Diagnosis of coronavirus

How To Diagnose Coronavirus In Lab

2 years ago 1041

How coronavirus is diagnosed in a lab?

Up to this date, the only method for diagnosis of coronavirus is real-time PCR/ Quantitative (qPCR) and Reverse Transcription (RT-PCR).

What is PCR? And what’s its difference with real-time PCR?

Real-time PCR is similar to that of commonly used PCR. The only difference is Real-time PCR is provided with a fluorescent-tagged nucleic acid probe (single strained oligonucleotide) which measures the amount of amplified product in real time.

What is PCR?

PCR is the amplification (cloning) process of certain target DNA; making large amounts of identical copies of specific DNA fragments.
 
Similarly, the process of measuring no. of those produced copies of DNA in terms of emitted light intensity by fluorescent molecules of DNA probe is called real-time PCR
 
Requirement of PCR

1) Target DNA - which needs to amplify.

2) Heat resistance Taq DNA polymerase- For elongation of DNA strand.
    (Due to high temperature commonly used DNA polymerase can be denatured. Before the invention of Taq-DNA polymerase in every cycle, DNA polymerase is added as it gets denatured in every cycle)
 
3) Two DNA primers- initiator for new DNA synthesis
    (Made up of 20-30 base pairs) having a base sequence complementary to the base sequence of flanking regions of target DNA in 5’ and 3D’ end.
 
4) All four deoxynucleoside triphosphates (dNTP) eg. dATP, dCTP, dTTP, dGTP which is building blocks from which DNA polymerase synthesized a new DNA strand.
 
5) A buffer solution

6) Mg++ cations

Basic 3 steps for PCR

  1. Denaturation of target DNA
  2. Annealing of primers to target DNA
  3. Elongation of the primer to form complementary DNA

Explanation:

--Temperature raised up to 95*C
-- Raise in temperature — causes double-stranded DNA to melt.
-- Melting occurs due to the break down of H-bond between purines and pyrimidine bases.
 
-- Temperature lowered to 50-60*C
-- When the temperature is lowered, specific constructed primers complementary to the flanking sequence of DNA strands bind to a sequence.
-- A large amount of primer ensures the binding of the primer to the DNA strand.
-- Primer acts as an initiator for DNA elongation
 
-- Temperature raised to 72*C
-- Then, Taq DNA polymerase keeps adding new dNTPs complementary to the template DNA strands.
 
Now, to detect the generation of new amplifiers in real-time, the PCR reaction requires an additional ingredient- a single-stranded DNA probe(with fluorescent molecule)— designed to hybridize to the part of the DNA sequence synthesized between the two primers.
 
Structure of DNA probes and its Mechanism of working.
DNA probes are radiolabeled or fluorescent-tagged single-stranded oligonucleotides made of 20-30 nucleotides used to detect target DNA.
-- One nucleotide in the terminal end is labeled with a fluorescent molecule— which illuminates light
 
-- Another nucleotide on another terminal end is labeled with a Quencher tag— which rapidly absorbs any light emitted by the fluorescent molecule as long as it remains close to fluorescent molecules.
 
-- Primers bind to separate strands of DNA. The probe also finds its complementary site between them.
 
 
The DNA polymerase (an enzyme) synthesis a new DNA strand from the ends of primers and also has a second activity; an exonuclease activity.
So, when it encounters double-stranded DNA in its path, it will disassemble the nucleotide of a strand that is in its way of elongation and replace them by another nucleotide.
 
As DNA polymerase passes through the probe, the nucleotide bearing the fluorescent marker and the one bearing the Quencher are separated from one another.
That is Probes (composed of nucleotides), are replaced by nucleotides that are being added by Tad-DNA Polymerasewhich leads to dissemble of DNA probes.
 
In the absence of a nearby Quencher molecule, the fluorescent molecule can now emit detectable light when stimulated by hv- rays.
 
This process ensures that if no PCR takes place, then no light will be available to detect by the PCR machine as the Quencher tag readily absorb the light.
  In case, PCR takes place in DNA polymerase to disassociate the nucleotide of DNA probes resulting in the separation of Fluorescent and Quencher molecules. Thus this separation ensures that now Quencher molecule can no longer absorb the light from the fluorescent molecule making the test result to positive.
 
But are those processes enough for a virus to detect?
 
Probably not; the virus contains single-stranded RNA. But PCR needs double-stranded DNA.
 
Thus for the detection of the virus, an additional process is needed; this is the reserve transcription process in which DNA is synthesized from an RNA template catalyzed by Reserve Transcriptase (which is an RNA-dependent DNA polymerase)
 
The new DNA strand synthesized has a base sequence complementary to the base sequence of the RNA template. So it is called complementary DNA (cDNA).
 
Now the RNA template used to make complementary DNA is degraded by ribonuclease-H leaving only single-stranded DNA which now acts as a template for the synthesis of its complementary DNA strand to make double-stranded DNA.
 
Now, this newly formed DNA from RNA virus is now can be used in PCR for virus genome detection.
 
Detection For Corona Virus
 
1. Collection of sample
 
As coronavirus is related to respiratory disease, using a sterile long stick (like an earbud), trainee medical worker swabs inside of your nose or back of the throat; this aims to collect materials
that have recently been in your lungs, where the virus is believed to replicate.           
  •  Upper respiratory specimens: nasopharyngeal or oropharyngeal swab
  •  Lower respiratory specimens; sputum if produced.

2. RNA extraction (Separation from human cells, protein, and enzyme)

3. Addition of reverse transcriptase enzyme for converting to DNA from single-strand RNA

4. Then DNA was added to the test tube containing a mixture of Primers, the large amount of isolated all 4 loose nucleotides, Taq-DNA polymerase, buffer, Mg++ ion, and DNA probes labeled with a fluorescent molecule.

5. These mixtures are placed in the PCR machine; which has a thermal cycle for regulating temperature for the amplification of target DNA.

6. The cycle is normally related to 30-45 cycles producing millions of target colonized DNA.

7. When there is a presence of target DNA, according to which primer and DNA probes are synthesized, these bind with strands of target DNA.

8. Then DNA polymerase destroys the DNA probes releasing fluorescent molecules from Quencher molecules of the DNA probe. Thus, when fluorescent molecules are stimulated by hv rays, enough light is emitted. Increase the number of PCR cycles to ensure insure amount of light increasing light intensity to be measured by the PCR machine denoting the result for the presence of the virus.

If no virus, it means the absence of target DNA. Thus no destruction of DNA probes, resulting in the failure of separation of fluorescent molecules from the Quencher molecule.

Thus, every time when hv rays stimulated fluorescent molecules, light is emitted but immediately absorbed by Quencher molecules resulting in less light intensity below a normal threshold. Thus result denoting to negative.

Molecular assays available protocols to diagnosis 2019-n CoV

Several research laboratories across the world have used primers against specific genes for virus to detect 

Country Institute Gene target
China
China CDC
ORF1a b, N
Germany
Charite
RdRP(specific fragment of ORF1b), E, N
Hong Kong SAR
HKU
ORF 1b-nsp14, N
Japan
National Institute of Infectious Disease, 
Department Of Virology III
Pan corona &
Multiple targets Spike protein
France
Institute Pasteur, Paris
Two targets in RdRP
US
US CDC
Three targets in RdRP
Thailand
National Institute of Health                                   
N 

 

  • This above ORF1a, ORF1b, N, E are the proteins present in the virus, and target gene corresponding to their names.
  • Thus, the main theme is we have to discover the gene sequence of the virus which code for the production of those above proteins.

 

Specific Primers and probes used for 2019 novel Coronavirus detection

For Target 1 (QRF1ab):

(Primers needed for the formation of the gene which code for the production of ORF1a,b proteins) 
Forward primer (F)
CCCTGTGGGTTTTACACTTAA
 
Reserve primer (R)
ACGATTGTGCATCAGCTGA
 
Fluorescent probe (P)
5’— FAM-TTGCTGCTGCTTGACAGATT-BHQ1–3’

 

For Target 2 (N gene)

Forward primer (F)
GGGGAACTTCTCCTGCTAGAAT
 
Reserve primer (R)
CAGACATTTTGCTCTCAAGCTG
 
Fluorescent probe (P)
5’—FAM-TTGCTGCTGCTTGACAGATT—TAMRA-3’